Please enter something

Chapter 14: Mutation, DNA Repair, and Cancer

question

Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the b-globin gene? silent missense nonsense frameshift sense
answer

missense
question

What would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? a silent point mutation with no deleterious effects a missense point mutation resulting in the change of one amino acid a nonsense point mutation resulting in the generation of a premature stop codon a frameshift mutation, producing a different amino acid sequence altogether All of the choices are possible.
answer

a frameshift mutation, producing a different amino acid sequence altogether
question

Which of the following would occur from a mutation in the gene’s promoter region? The sequence of the mature mRNA would change. The ability of pre-mRNA to be properly spliced would change. The ability of mRNA to be translationally regulated would change. The amino acid sequence of the translated protein would be altered. The rate of transcription may increase or decrease.
answer

The rate of transcription may increase or decrease.
question

A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein? nonsense mutation missense mutation silent mutation sense mutation frameshift mutation
answer

nonsense mutation
question

What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDBATPAW nonsense missense silent sense frameshift
answer

missense
question

Which of the following is true concerning a somatic cell mutation? A small fraction of the gametes carry the mutation. Half of the gametes carry the mutation. All of the gametes carry the mutation. Only a small group of cells within the organism is affected by the mutation. All cells within the organism are affected by the mutation.
answer

Only a small group of cells within the organism is affected by the mutation.
question

Which of the following results in a spontaneous mutation? Free radicals produced by cellular metabolism Exposure to ultraviolet light Exposure to benzo (a)-pyrene, a chemical substance found in cigarette smoke Exposure to ultraviolet light and benzo (a)-pyrene Exposure to X-rays
answer

free radicals produced by cellular metabolism
question

Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp base addition – silent substitution – misense base addition – missense substitution – nonsense base addition-frameshift
answer

base addition-frameshift
question

All of the following are chemical mutations EXCEPT nitrogen mustard. X-rays. ethyl methanesulfonate. hydroxylamine. nitrous acid.
answer

X-rays.
question

Ionizing radiation can produce which of the following? cytosine free radicals stop codons thymine dimers hypoxanthine
answer

free radicals
question

Which of the following types of physical mutagens produces thymine dimer mutations? ultraviolet light X-rays microwave gamma rays ionizing radiation
answer

ultraviolet light
question

In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive. A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? The newly synthesized compound induces a mutation in the bacteria. The bacteria no longer produce histidine. The bacteria produce histidine. The newly synthesized compound induces a mutation in the bacteria and the bacteria no longer produce histidine. The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine.
answer

The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine.
question

A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure. Which of the following DNA repair systems is responsible for the correction? base excision repair direct repair indirect repair nucleotide excision repair methyl-directed mismatch repair
answer

direct repair
question

Which of the following CANNOT be repaired by nucleotide excision repair (NER)? ultraviolet-induced damage chemically modified bases missing bases mismatched bases pyrimidine dimers
answer

mismatched bases
question

Which of the following LEAST belongs with the others? thymine dimer UvrA protein direct repair nucleotide excision repair UvrC protein
answer

direct repair
question

Which of the following diseases is associated with faulty DNA repair mechanisms? Alzheimer’s disease diabetes xeroderma pigmentosum diabetes and xeroderma pigmentosum Alzheimer’s disease and diabetes
answer

xeroderma pigmentosum
question

Which of the following base pairs would be targeted and repaired by a mismatch repair system? A -T C-G A-G A-G and C-G A-T and C-G
answer

A-G
question

Which of the following statements about methyl-directed mismatch repair systems is FALSE? Methyl-directed mismatch repair systems require the concerted actions of several proteins. Methyl-directed mismatch repair systems require exonucleases. Methyl-directed mismatch repair systems are most often used to correct pyrimidine dimers. Methyl-directed mismatch repair systems exist in all species. Methyl-directed mismatch repair systems recognize incorrectly matched base pairs in the DNA.
answer

Methyl-directed mismatch repair systems are most often used to correct pyrimidine dimers.
question

What is the function of the MutS protein in methyl-directed mismatch repair? To excise the mismatched basepair. To find mismatches. To directly bind the DNA polymerase. To make a cut in the nonmethylated DNA strand. To digest the nonmethylated DNA strand.
answer

To find mismatches.
question

Which of the following statements about cancer is FALSE? It is characterized by uncontrolled cell division. Over 1 million Americans are diagnosed with cancer each year. Most cancers involve genetic changes that are passed from parent to offspring. At least 80% of all human cancers are related to exposure to carcinogens. It is caused by an accumulation of mutations.
answer

Most cancers involve genetic changes that are passed from parent to offspring.
question

Which of the following is an overgrowth of cells that serves no useful purpose? tumor oncogene proto-oncogene growth callus
answer

tumor
question

When cancer cells have the ability to migrate to other parts of the body, they are said to be invasive. benign. metastatic. oncogenic. genetic.
answer

metastatic.
question

A mutation causes a gene to become overactive, contributing to uncontrolled cell growth. Which term best describes this gene? tumor-suppressor gene oncogene spliced gene alternatively spliced gene malignant gene
answer

oncogene
question

Which of the following is most likely to occur when a tumor-suppressor gene is mutated? The tumor-suppressor gene may be overactive. The resulting tumor-suppressor protein would further suppress cell proliferation. The resulting tumor-suppressor protein would activate an oncogene. The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. None of the choices are possible.
answer

The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation.
question

Which of the following cellular proteins is NOT a part of the epidermal growth factor (EGF)/EGF receptor signaling pathway that leads to cell division? GRB2, Sos, and Ras Raf-1 MAPK Myc and Fos-Jun MutS
answer

MutS
question

Which of the following proteins is a transcriptional factor that binds genes and regulates the transcription of genes that promote cell division? GRB2 epidermal growth factor myc raf-1 MAPK
answer

myc
question

MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) spliceosome. transposon. tumor-suppressor gene. oncogene. None of the choices are correct.
answer

oncogene.
question

_______ can convert proto-oncogenes into oncogenes. Gene amplifications Retroviral insertions Chromosomal translocations Missense mutations All of these choices are correct
answer

All of these choices are correct
question

If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone a missense mutation. gene amplification. a chromosomal translocation. retroviral insertion. a nonsense mutation.
answer

gene amplification.
question

Which of the following events must occur to cause a chromosomal translocation? One chromosome must break in two distinct locations. Two different chromosomes must break. A transposon must be present in one of the chromosomes. The broken ends must pair correctly. A mutation in the DNA must occur.
answer

Two different chromosomes must break.
question

A gene created from the fusion of two gene fragments is considered a tumor-suppressor gene. proto-oncogene. structural gene. regulatory gene. chimeric gene.
answer

chimeric gene.
question

A physician discovered a cancerous tumor in the cartilage of a patient. What type of tumor is this? myoloma retroviral sarcoma leukemia cyst
answer

sarcoma
question

Which of the following is the cancer of epithelial cells? sarcoma lymphoma leukemia carcinoma myoloma
answer

carcinoma
question

All of the following tumor-suppressor genes inhibit cell division EXCEPT BRCA1. Rb. NF1. p16. all of these are tumor suppressor genes
answer

all of these are tumor suppressor genes
question

Which of the following viruses can cause cancer? Rous sarcoma virus hepatitis B papillomavirus Epstein-Barr virus All of the choices are correct.
answer

All of the choices are correct.
question

Should a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. cis-acting elements checkpoint proteins trans-acting elements growth factors Ras’s
answer

checkpoint proteins
question

Which protein directs apoptosis? growth factor oncogene chimeric gene caspase transposase
answer

caspase
question

Which of the following is NOT a typical cellular change that occurs during lung cancer? cellular hyperplasia loss of ciliated cells cellular displasia elevated gas transport increases in basal cell number and thickening of epithelium
answer

elevated gas transport
question

At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? S G2 M G0 G1
answer

G1
question

Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? caspases cyclins claudins endonucleases cofactors
answer

cyclins
question

You are a brilliant graduate student and you are skeptical of the results found by the Lederbergs. You decide to repeat their experiment, but you do not have ready access to T1 bacteriophage. What might you use instead? HIV virus HPV virus X-gal – the substrate of the enzyme β-galactosidase Ampicillin – an antibiotic Salmonella bacteria
answer

Ampicillin – an antibiotic