FINAL/EXAM 4 – DNA – Flashcards
Unlock all answers in this set
Unlock answersquestion
            The monomers of DNA and RNA are A) nucleotides. B) nucleic acids. C) monosaccharides. D) fatty acids.
answer
        A) nucleotides.
question
            Which of the following statements regarding DNA is false?   One DNA molecule can include four different nucleotides in its structure.  DNA molecules have a sugar-phosphate backbone.  DNA uses the sugar deoxyribose.  DNA uses the nitrogenous base uracil.
answer
        DNA uses the nitrogenous base uracil.
question
            Which of the following statements regarding RNA is false? A) RNA uses the sugar dextrose. B) RNA molecules have a sugar-phosphate backbone. C) RNA uses the nitrogenous base uracil. D) One RNA molecule can include four different nucleotides in its structure.
answer
        A) RNA uses the sugar dextrose.
question
            What nucleotide sequence would be found on the partner DNA strand of the strand shown?  A C T G T  A) TGACA B) TGUGU C) UGAGA D) ACTGT
answer
        A) TGACA
question
            During replication, the original "parent" DNA _____. A) is converted to RNA B) is incorporated into the new DNA strand C) is broken down as a new DNA strand forms D) serves as the template for the creation of two complete sets of DNA
answer
        D) serves as the template for the creation of two complete sets of DNA
question
            Which of the following enzymes catalyzes the elongation of a new DNA strand? A) helicase B) DNA polymerase C) ligase D) single-stranded binding protein
answer
        B) DNA polymerase
question
            Which of the following options best depicts the flow of information when a gene directs the synthesis of a cellular component? A) RNA → DNA → RNA → protein B) DNA → tRNA → mRNA → protein C) protein → RNA → DNA D) DNA → RNA → protein
answer
        D) DNA → RNA → protein
question
            The transfer of genetic information from DNA to RNA is called A) translation. B) initiation. C) elongation. D) transcription.
answer
        D) transcription.
question
            The "one gene-one polypeptide" theory states that A) the function of each polypeptide is to regulate the synthesis of each corresponding gene. B) the synthesis of each gene is catalyzed by one specific enzyme. C) the synthesis of each enzyme is catalyzed by one specific gene. D) the function of an individual gene is to dictate the production of a specific polypeptide.
answer
        D) the function of an individual gene is to dictate the production of a specific polypeptide.
question
            Experiments have demonstrated that the "words" of the genetic code (the units that specify amino acids) are A) two-nucleotide sequences. B) nucleotide sequences of various lengths. C) single nucleotides. D) three-nucleotide sequences.
answer
        D) three-nucleotide sequences
question
            The directions for each amino acid in a polypeptide are indicated by a codon that consists of ________ nucleotide(s) in an RNA molecule. A) 4 B) 2 C) 3 D) 5
answer
        C) 3
question
            In transcription, _____. A) both DNA strands are used as the templates B) the promoter region acts as an initial binding site for mRNA C) RNA polymerase links nucleotides to form mRNA. D) a polypeptide is formed
answer
        C) RNA polymerase links nucleotides to form mRNA.
question
            ________ marks the end of a gene and causes transcription to stop. A) Methionine B) A terminator C) RNA polymerase D) RNA ligase
answer
        B) A terminator
question
            An anticodon is _____. A) a set of triplet bases that is complementary to a codon triplet on mRNA B) the DNA sequence that is complementary to a triplet codon in a mRNA molecule, for example, CTC C) the amino acid attachment site in a tRNA molecule D) an enzyme that specifically binds one type of amino acid to its appropriate tRNA molecule
answer
        A) a set of triplet bases that is complementary to a codon triplet on mRNA
question
            Which of the following is not needed in order for translation to occur? A) sources of energy, including ATP B) tRNA C) DNA template D) ribosomes
answer
        C) DNA template
question
            How do mutations affect an organism? A) they may cause the development of a disease-causing allele B) they may cause the development of a more beneficial allele C) they, in some cases, may have no noticeable affect D) all of the above
answer
        D) all of the above
question
            DNA replication occurs at an unbelievably fast rate. Once replication is complete, we can expect to find a _____ number of mistakes. A) average B) large C) small
answer
        C) small
question
            A female that is planning to become pregnant is concerned about her exposure to environmental mutagens which may have caused DNA mutations. In order for these mutations to become heritable, they must affect the: A) all of her cells B) somatic cells C) her egg cells
answer
        C) her egg cells
question
            Which of the following would indicate a base pairing mutation in DNA? A) an A paired with a T B) a C paired with a G C) a G paired with a T D) all of the above are improper base pairs
answer
        C) a G paired with a T
question
            The type of mutation represented below is a(n) _____.  The big red fly had one eye (wild type)  The fbi gre dfl yha don eey (mutant) A) addition of a codon B) deletion C) single base substitution D) shift in reading frame
answer
        D) shift in reading frame
question
            Any change in the nucleotide sequence of DNA is called A) an anticodon. B) a mutation. C) a mutagen. D) a base substitution.
answer
        B) a mutation.
question
            A physical or chemical agent that changes the nucleotide sequence of DNA is called a(n) A) transposon. B) terminator. C) anticodon. D) mutagen.
answer
        D) mutagen.
question
            Which of the following is an example of a transgenic organism? A) a bacterium with human gene for producing insulin B) Dolly, the cloned sheep C) a bacterium found with a plasmid that provides protection against an antibiotic D) a "test-tube" baby produced via in vitro fertilization
answer
        C) a bacterium with human gene for producing insulin
question
            Restriction enzymes __________________________. A) bind DNA together at specific nucleotide sequences B) cut DNA at specific nucleotide sequences C) restrict access to the DNA of a cell D) copy DNA
answer
        B) cut DNA at specific nucleotide sequences
question
            The process of accurately amplifying a sample of DNA is called __________________________. A) the polymerase chain reaction B) recombinant DNA C) short tandem repeats D) gel electrophoresis
answer
        A) the polymerase chain reaction
question
            Gel electrophoresis separates pieces of DNA based on _________. A) charge B) size C) sequence D) quantity
answer
        B) size
question
            A supplemental appendix is to a book as a ____________ is to a bacterial chromosome. A) genetically modified organism B) bacterium C) restriction enzyme D) plasmid
answer
        D) plasmid
question
            Plasmids are extrachromosomal pieces of DNA that are not necessary for the "housekeeping" activities of the cell. When constructing a recombinant molecule, genetic engineers frequently use plasmids that have at least one gene for antibiotic resistance. Antibiotics can then be applied to the media on which bacterial cells may be growing. What is the best explanation for this practice? A) The antibiotic resistance gene makes the bacteria more likely to express the target DNA. B) It allows detection of the bacteria that have been transformed with this plasmid and therefore the gene of interest. C) It is easier to insert the target gene with another gene. D) It allows the bacteria to be killed when no longer useful.
answer
        B) It allows detection of the bacteria that have been transformed with this plasmid and therefore the gene of interest.
question
            When DNA from two sources is combined into one single piece of DNA, it is known as A) cloned DNA. B) a plasmid. C) a vector. D) recombinant DNA.
answer
        D) recombinant DNA.
question
            In the process of human gene cloning using plasmids, the bacterial plasmid A) is the source of the gene to be cloned. B) functions as a vector. C) is used to insert the human gene into the bacterial chromosome. D) is cultured inside the human cell, which contains the gene to be cloned.
answer
        C) is used to insert the human gene into the bacterial chromosome.
question
            DNA ligase binds A) nucleotides together. B) polymerase to the promotor. C) exons together. D) an intron to an exon.
answer
        A) nucleotides together.
question
            The unpaired nucleotides produced by the action of restriction enzymes are referred to as _____. A) sticky ends B) base sequences C) single strands D) restriction fragments E) ligases
answer
        A) sticky ends
question
            The sticky end of the DNA restriction fragment shown here will pair with a DNA restriction fragment with the sticky end _____. A) -ACGT B) -AAAA C) -ACGU D) -GTAC E) -TGCA
answer
        A) -ACGT
question
            Which of the following restriction enzymes cuts the following DNA? Assume that ^ determines the cut site.  GCATTACGGGATCCACCCGTT  A) Alu (AG^CT) B) EcoRI (G^AATTC) C) BamHI (G^GATCC) D) HindIII (A^AGCTT)
answer
        C) BamHI (G^GATCC)
question
            ________ are a major source of restriction enzymes. A) Bacteria B) Archaea C) Chief cells D) Parietal cells
answer
        A) Bacteria
question
            Which step in the creation of cDNA involves the use of reverse transcriptase? A) step 1 B) step 2 C) step 3 D) step 4
answer
        C) step 3
question
            The enzyme that converts information stored in their RNA to information stored in DNA is A) a restriction enzyme. B) DNA ligase. C) RNA polymerase. D) reverse transcriptase.
answer
        D) reverse transcriptase.
question
            A cDNA library differs from a genomic library in that A) the cDNA was constructed from introns only. B) cDNA libraries are more stable. C) cDNA libraries only contain information from genes that have been transcribed. D) genomic libraries are only stored in bacterial cells.
answer
        C) cDNA libraries only contain information from genes that have been transcribed.
question
            An advantage of using reverse transcriptase to prepare a gene for cloning is that A) the resulting DNA strand will lack exons. B) reverse transcriptase is more efficient than RNA polymerase. C) the resulting DNA strand will lack introns. D) reverse transcriptase is more efficient than DNA polymerase.
answer
        C) the resulting DNA strand will lack introns.
question
            A nucleic acid probe is A) a virus that transfers DNA to a recipient cell. B) a plasmid that recognizes a specific DNA sequence. C) a piece of radioactively labeled DNA that is used to locate a specific gene. D) an enzyme that locates a specific restriction site on RNA.
answer
        C) a piece of radioactively labeled DNA that is used to locate a specific gene.
question
            Human growth hormone is a secreted protein that stimulates growth and cell reproduction. In the 1960s it was discovered that this was an effective treatment for a form of dwarfism. However, before it was genetically engineered, it was _____. A) synthesized chemically B) not available C) harvested from cadavers D) substituted with similar animal proteins
answer
        C) harvested from cadavers
question
            The only recombinant cells that can correctly attach sugars to proteins to form glycoprotein products are A) yeast cells. B) algal cells. C) mammalian cells. D) E. coli cells.
answer
        C) mammalian cells.
question
            The advantage of being able to clone the gene for human insulin is that A) using human insulin increases the probability that, in the future, the person suffering from diabetes can be weaned from a dependence on insulin. B) cow, pig, or horse insulin cannot keep a diabetic alive for more than three months. C) there are too few cows, pigs, and horses to provide an adequate supply of their insulin. D) human insulin is less likely to cause harmful side effects than cow, pig, or horse insulin.
answer
        D) human insulin is less likely to cause harmful side effects than cow, pig, or horse insulin.
question
            A vaccine works by A) inhibiting bacterial replication. B) stimulating the immune system. C) inhibiting viral replication. D) preventing the translation of mRNA.
answer
        B) stimulating the immune system.
question
            Which of the following statements about DNA technology is false? A) DNA technology is now used to mass-produce human insulin. B) DNA technology is now used to create cells that can identify and kill cancer cells. C) DNA technology is now used to produce vaccines that are harmless mutants of a pathogen. D) DNA technology is now used to mass-produce human growth hormone.
answer
        B) DNA technology is now used to create cells that can identify and kill cancer cells.
question
            Plants are being engineered to be resistant to pesticides; therefore, _____. A) the nutritional value of the plants will improve B) the plants provide humans who consume them with the same resistance C) the plants will require fewer nutrients D) farmers can reduce chemical use
answer
        D) farmers can reduce chemical use
question
            Golden rice is golden in color because it is rich in A) vitamin C. B) beta-carotene. C) vitamin A. D) chromium picolinate.
answer
        B) beta-carotene.
question
            A transgenic animal is A) an animal in which a genetic defect has been corrected using recombinant DNA therapy. B) an animal containing a gene from another organism, typically of another species. C) an animal containing genes from three or more species. D) an animal that is the first of its kind to bear a particular allele.
answer
        B) an animal containing a gene from another organism, typically of another species.
question
            Why is golden rice pale yellow in color? A) It is rich in chlorophyll a. B) It is nutrient-poor. C) It is rich in beta-carotene. D) It is rich in chlorophyll b. E) It is rich in phycobilins.
answer
        C) It is rich in beta-carotene.
question
            Which of these is a symptom of vitamin A deficiency? A) osteoporosis B) impaired taste perception C) overstimulation of the immune system D) blindness E) impaired blood clotting
answer
        D) blindness
question
            Which of these is a vitamin A precursor? A) cobalamin B) pyridoxine C) plasmid D) beta-carotene E) thiamin
answer
        D) beta-carotene
question
            The transfer of antibiotic-resistant genes from genetically engineered bacteria to disease-causing bacteria _____. A) would, if it occurred, be no cause for concern B) has occurred C) is likely to occur D) can never occur E) seems unlikely
answer
        E) seems unlikely
question
            Which of the following has not been a significant issue in the creation of genetically modified (GM) organisms? A) the fact that GM organisms cannot be modified to prevent them from reproducing once they pass beyond the experimental stage B) the fact that rogue microbes might transfer dangerous genes into other organisms C) the fact that the protein products of transplanted genes might lead to allergic reactions D) the fact that some plants carrying genes from other species might represent a threat to the environment
answer
        A) the fact that GM organisms cannot be modified to prevent them from reproducing once they pass beyond the experimental stage
question
            What is the preferred name of the technique used to determine if DNA comes from a particular individual? A) DNA scrutiny B) DNA outline C) DNA profiling D) DNA fingerprinting
answer
        C) DNA profiling
question
            In a PCR reaction, the strands of DNA are first separated by ___. A) treatment with an acid B) heating C) adding alcohol D) treatment with a strong base
answer
        B) heating
question
            When is PCR particularly applicable? A) When there are small quantities of DNA to analyze B) When speed is important but accuracy is not C) When there are large quantities of DNA to analyze D) When the accuracy is important, but speed is not
answer
        C) When there are small quantities of DNA to analyze
question
            What is the correct sequence of events that occur in a PCR reaction? A) addition of primers; use of DNA polymerase to produce second strand of DNA; DNA strand separation B) separation of DNA strands; use of DNA polymerase to produce a second strand of DNA; addition of primers C) use of DNA polymerase to produce a second strand of DNA; separation of DNA strands; addition of primers D) separation of DNA strands; addition of primers; use of DNA polymerase to produce second strand of DNA
answer
        D) separation of DNA strands; addition of primers; use of DNA polymerase to produce second strand of DNA
question
            DNA polymerase is a heat-sensitive enzyme. What is one thing that would need to be considered concerning the activity of this enzyme in PCR when the temperature is heated during each cycle to separate the DNA strands? A) that the DNA strands might melt B) that the primers might not work C) that the DNA polymerase could be denatured
answer
        C) that the DNA polymerase could be denatured
question
            The polymerase chain reaction relies upon unusual, heat-resistant ________ that were isolated from bacteria living in hot springs. A) DNA polymerase molecules B) plasmids C) phages D) restriction enzymes
answer
        A) DNA polymerase molecules
question
            In gel electrophoresis DNA molecules migrate from _____ to _____ ends of the gel. A) acidic ... basic B) negative ... positive C) basic ... acidic D) long ... short E) positive ... negative
answer
        B) negative ... positive
question
            Which of the following statements regarding repetitive DNA is false? A) Repetitive DNA is usually repeated multiple times in the genome. B) Repetitive DNA can show great variation among individuals. C) Repetitive DNA is usually found between genes. D) Repetitive DNA is identical in all humans.
answer
        D) Repetitive DNA is identical in all humans.
question
            When genetic variation in one nucleotide is found in at least 1% of the population, it is known as A) single nucleotide polymorphism. B) short tandem repeats. C) variable DNA. D) recombinant DNA.
answer
        A) single nucleotide polymorphism.
question
            For the first time, the U.S. Food and Drug Administration is considering whether to allow the sale of _____. A) food from a genetically altered animal B) fungi as food C) seaweed as a drug D) endangered species of plants
answer
        A) food from a genetically altered animal
question
            The fish in the video have been genetically engineered to _____. A) resist bacterial infections B) grow faster C) reproduce later in life D) produce pink meat
answer
        B) grow faster
question
            The modified salmon were created by _____. A) adding genetic material from a Pacific salmon and an eel-like fish B) fusing salmon and shark eggs C) producing only male salmon, which tend to be larger than females D) injecting the salmon with steroids, such as testosterone
answer
        A) adding genetic material from a Pacific salmon and an eel-like fish
question
            According to the producers of the genetically modified salmon, the meat _____. A) tastes like chicken B) has a distinctly different taste from unmodified salmon C) has a distinctly different color from unmodified salmon D) looks and tastes the same as unmodified salmon
answer
        D) looks and tastes the same as unmodified salmon
question
            What concerns do some consumer groups have about genetically modified fish? A) They want more studies on the health effects that genetically modified fish may have on people who eat it. B) They want to prevent genetically modified fish from breeding with wild fish. C) They want food from genetically modified fish to be clearly labeled as genetically modified. D) all of the above
answer
        D) all of the above
question
            How does the company raising these fish claim to prevent the genetically modified fish from breeding with wild fish? A) The genetically modified fish are sterile. B) Escaped fish are caught and removed from the ocean. C) Fish are raised in individual isolation and are unable to interact with each other. D) The fish are killed before they are old enough to reproduce.
answer
        A) The genetically modified fish are sterile.
question
            Research indicates that the best estimate of your age is from ______. A) your body mass index (BMI) B) the number of days you've lived C) markers in your cells D) the number of minutes you exercise every week
answer
        C) markers in your cells
question
            The cells examined from the 2,400 people in this study were from ______. A) skin scrapings B) hair C) blood D) surgically removed tissue
answer
        C) blood
question
            Which of the following damages cells and causes cell aging? A) reducing stress B) exercise C) inflammation D) all of the above
answer
        C) inflammation
question
            The researchers used strands of DNA located at the ends of chromosomes (called telomeres) to classify the cells they studied. What assumption did they make about telomeres? A) Shorter telomeres indicate younger cells. B) Longer telomeres indicate younger cells. C) Telomere length is not an accurate indicator of cell age. D) Longer telomeres indicate that the person from whom the cells came does not exercise.
answer
        B) Longer telomeres indicate younger cells.
question
            The researchers found that telomeres were ______. A) shorter in smokers who exercised compared to those who did not exercise B) shorter in individuals who ate less and exercised regularly C) longer in individuals who exercised regularly D) longer in nonsmokers who did not exercise compared to those who did exercise
answer
        C) longer in individuals who exercised regularly
