BIO – Biology Flashcards

Drag the labels onto the diagram to identify the components of replicating DNA strands.

Drag the labels onto the diagram to identify the stages in which the lagging strand is synthesized.

Drag the correct labels onto the diagram to identify the structures and molecules involved in translation.

The central dogma describes how the genes in the nucleus work to produce an organism's phenotype. Another way of putting it is that the central dogma follows the flow of information from _____. A. protein to DNA B. protein to RNA C. DNA to protein D. RNA to ribosomes

DNA carries out two basic functions in cells: (1) information storage and transfer (genes can be copied and passed to offspring) and (2) the "blueprint" function (genes provide instructions for building proteins). The key process for information storage and transfer to offspring cells is _____. A. DNA replication B. transcription C. translation D. mRNA processing

A gene is a sequence of DNA nucleotide bases that codes for a single protein. Approximately how many nucleotide bases would be required to code for a protein chain that is 100 amino acids long? A. 100 B. 300 C. 20 D. 4

tRNA molecules work to _____. A. transcribe DNA to mRNA B. translate DNA to produce a specific amino acid sequence C. transcribe the amino acid sequence to DNA D. translate mRNA to produce a specific amino acid sequence E. none of the above

A particular gene does NOT constantly churn out the same protein at all times in every cell. This is true for two reasons. First, _____ can allow one gene to produce several different proteins. Second, genes are constantly being turned on and off through the process of _____. A. translation ... reverse transcription B. reverse transcription ... mRNA reprocessing C. mRNA reprocessing ... gene regulation D. mRNA reprocessing ... transcription

Drag pink labels to pink targets to identify the name of each process. Drag blue labels to blue targets to identify where in the cell each process occurs. Labels may be used once, more than once, or not at all.

Your aunt has hepatitis C. Which of the following organs is she most likely to need transplanted? A. lung B.kidney C. heart D. liver

Which of the following is true? A. A patient with hepatitis C may or may not develop serious health problems. B. A patient with hepatitis C will not develop serious health problems. C. A patient with hepatitis C will develop serious health problems. D. A patient with hepatitis C will die from the disease if no treatment is given.

Which of the following diseases is caused by an organism most similar to the organism that causes hepatitis C? A. Legionnaire's disease, caused by a bacterium B. Tay-Sachs, a genetic disorder C. malaria, caused by a protozoan parasite D. Ebola, caused by a virus

You are a physician specializing in the most common form of hepatitis C in the United States. What is your area of expertise? A. Hepatitis C, genotype 2 B. Hepatitis C, genotype 3 C. Hepatitis C, genotype 1 D. Hepatitis C, genotype 4

Assuming no apparent health problems, which of the following individuals is most likely to be recommended to be tested for hepatitis C by the Centers for Disease Control and Prevention and the U.S. Preventive Services Task Force? A. A woman born in 1938. B. A man born in 1955. C. A man born in 1986. D. A woman born in 1973.

If you analyzed the nucleotide content of DNA, you would expect to find that __________. A. the ratio of A to C is close to 1:1 and the ratio of G to T is close to 1:1B. A + T = G + CC. the ratio of A to G is close to 1:1 and the ratio of T to C is close to 1:1D. the ratio of A to T is close to 1:1 and the ratio of G to C is close to 1:1

Life on Mars is finally discovered and a new organism that has six different nucleotides that encode 30 different amino acids is found on this planet. Which of the following nucleotide combinations would encode the minimum number of amino acids needed in this organism? A. one-nucleotide sequence (6^1 combinations) B. three-nucleotide sequence (6^3 combinations) C. two-nucleotide sequence (6^2 combinations) D. four-nucleotide sequence (6^4 combinations)

Consider the following sequence and explain what effect the mutation has on the protein that is translated. UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type) UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant) A. no effect B. single amino acid change C. complete change in amino acid sequence after the mutation D. prematurely stops the translation of the protein

Which of the following statements correctly describes mRNA processing in eukaryotes? A. Exons are cut out, and the introns are spliced together. B. Exons are cut out and transported to smooth endoplasmic reticulum. C. Introns are cut out and spliced together at the end of the mRNA. D. Introns are cut out, and the resulting exons are spliced together.

The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a tRNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon? A. CUT B. CAT C. CAU D. GUA

If protein production were an assembly line, a ribosome would be _____. A. a loose piece that needs to be put together B. the worker who puts all of the pieces together C. the foreman who barks out instructions D. the machines that move pieces to their appropriate locations

A virus infects a cell and randomly inserts many short segments of DNA containing a stop codon throughout the organism's chromosomes. This will probably cause _____. A. incorrect pairing between mRNA codons and amino acids B. manufactured proteins to be short and defective C. no deleterious effects, as long as the stop codons are not also inserted into tRNA D. the DNA to break up into thousands of short segments

The drug AZT was one of the first drugs used to treat HIV. Which of the following drug actions would prevent the spread of HIV without harming the host cell? A. prevention of the formation of glycoproteins B. inhibition of DNA polymerase C. destruction of amino acids that are vital to viral protein synthesis D. inhibition of reverse transcriptase

Hershey and Chase were able to differentiate between proteins and nucleic acids using radioactive atoms of elements found only in those macromolecules. Which of the following would be found only in proteins? A. carbon B. hydrogen C. phosphorus D. sulfur

One type of virus that infects bacteria is called a A. rhinovirus. B. retrovirus. C. coronavirus. D. phage.